MrBayes (Bayesian Analysis of Phylogeny)

Category(ies): Bioinformatics

Version: 3.1.2

Author / Distributor:
Fredrik Ronquist, School of Computational Science, Florida State University, ronquist@csit.fsu.edu
John P. Huelsenbeck, Section of Ecology, Behavior and Evolution, Division of Biological Sciences, University of California, San Diego, johnh@biomail.ucsd.edu

Description:

MrBayes is a program for the Bayesian estimation of phylogeny. Bayesian inference of phylogeny is based upon a quantity called the posterior probability distribution of trees, which is the probability of a tree conditioned on the observations. It uses Markov chain Monte Carlo (or CMC) to approximate the posterior probabilities of trees.

altix: running program | Documentation | Installation | System

Running Program:

Run a serial version for small size data

Then follow the instruction on the screen. To quit the program, type q and ENTER. Use quit to quit the program.

quit

Run a parallel version with large data

* for tcsh, csh shell users

source /usr/local/bin/use_mpich.csh
mpirun -np 4 /usr/local/mrbayes/mbp

* for bash shell users

. /usr/local/bin/use_mpich.sh
mpirun -np 4 /usr/local/mrbayes/mbp

Where the "4" in parameter is the number of parallel processes. Users can set to 2 -8 based on their needs. For more than 4 processes, please contact rcc ahead for arrangement.
Then follow the instruction on the screen.

To quit the program, type q and ENTER

Documentation: http://mrbayes.csit.fsu.edu/wiki/index.php/Manual

Installation:

Source code downloaded from http://mrbayes.csit.fsu.edu/
Compiled by gcc

System(s): Unix

inQuiry: not available at inQuiry

pcluster: Not available on pcluster

rcluster,IOB: running program | Documentation | Installation | System

Running Program: also refer to submit jobs to queues at rcluster,IOB

Run a parallel version with medium size data on interactive node
When running MPI jobs on the rcluster interactive node (inter1), please first create a file host.list.
Refer to Running an Interactive Jobfor details about host.list.
Then run the mpirun command with:

ssh inter1
mpirun -np 4 -machinefile host.list /usr/local/mrbayes/mb

Where the "4" in parameter is the max number of parallel processes at node inter1. Users can set to 2 -4 based on their needs. For more than 4 processes, please contact rcc ahead for arrangement and use queue submit your job.
Then follow the instruction on the screen.

To quit the program, type q and ENTER

Run the job in the queue, refer to MrBayes
Define all the parameters in the .nex file, e.x. yh.nex

#NEXUS
begin mrbayes;
set autoclose=yes nowarn=yes;
execute primates.nex;
lset nst=6 rates=gamma;
mcmc nruns=1 ngen=10000 samplefreq=10 file=primates.nex1;
mcmc file=primates.nex2;
mcmc file=primates.nex3;
end;
begin data;
dimensions ntax=12 nchar=898;
format datatype=dna interleave=no gap=-;
matrix
Tarsius_syrichta AAGTTTCATTGGAGCCACCACTCTTATAATTGCCCATGGCCTCACCTCCTCCCTAT
.
Hylobates ATGCTGAACAACCACCCAGACACTACAACTCTCACTAAGCTT
.
end;

The orange color block defines all the parameters, brown part defines the data. Save this file as e.x. mbtest.nex, then submit to the queue.

Below is a script subp.sh to the batch queue

#!/bin/bash
cd /home/rccstaff/yhuang/iobdemo/mrbayesTest
echo $LSB_HOSTS
cat /dev/null > mlist.$$
for variable in $LSB_HOSTS; do
echo $variable >> mlist.$$
done
mpirun -np 4 -machinefile mlist.$$ /usr/local/mrbayes/mb < yh.nex > myout
rm -f mlist.$$

bsub -n 4 -q r4-24h -o mbtest.out.%J -e mbtest.err.%J ./subp.sh

Documentation: Same as altix

Installation: Same as altix

System(s): Unix